Maklumat

Wolbachia - ketidaksesuaian sitoplasma


Saya membaca bahawa ketidakcocokan sitoplasma di Wolbachia berlaku apabila serangga lelaki yang dijangkiti wolbachia kawin dengan serangga betina bebas wolbachia dan menghasilkan keturunan yang tidak layak. Sebaliknya, tuan rumah wanita yang dijangkiti wolbachia menghasilkan keturunan yang berjaya tanpa mengira status jangkitan pasangan mereka.

Saya tertanya-tanya - apakah kesan jangka panjang ini terhadap saiz / struktur populasi serangga? Bagaimana ini akan berbeza dengan populasi yang tidak dijangkiti?


Wolbachia kepelbagaian dan corak ketidaksesuaian sitoplasma di Pipiens Culex penduduk di Turki

Wolbachia adalah bakteria yang ditularkan oleh ibu yang dapat memanipulasi pembiakan inang mereka yang menyebabkan ketidaksesuaian sitoplasma (CI). CI adalah ketidaksesuaian telur sperma yang mengakibatkan kematian embrio. Kerana kesan pensterilan pada nyamuk ini, Wolbachia dipertimbangkan untuk strategi kawalan vektor. Vektor penting untuk arbovirus, nematoda filarial dan malaria burung, nyamuk Pipiens Culex kompleks sesuai untuk Wolbachia-kawalan vektor berdasarkan. Mereka dijangkiti Wolbachia wStrain pip tergolong dalam lima kumpulan yang berbeza secara genetik (wPip-I hingga V) di dalam Wolbachia Kumpulan super B. CI sifat wPip sangat berkaitan dengan kepelbagaian genetik ini: nyamuk yang dijangkiti wKetegangan paip dari yang lain wKumpulan pip lebih cenderung tidak sesuai antara satu sama lain. Turki adalah tempat kritikal untuk penyakit bawaan vektor kerana kedudukan geografinya yang unik sebagai jambatan semula jadi antara Asia, Eropah dan Afrika. Walau bagaimanapun, umum wKepelbagaian paip, taburan dan corak CI secara semula jadi Cx. pipiens (s.lpopulasi di rantau ini tidak diketahui. Dalam kajian ini, kami pertama kali mengenal pasti wKepelbagaian pip dalam bahasa Turki Cx. pipiens (s.l.) populasi, dengan menetapkan mereka kepada salah satu daripada lima kumpulan di dalamnya wPaip (wPip-Ito V). Kami seterusnya menyiasat sifat CI antara yang berbeza wKetegangan paip dari rantau ini.

Keputusan

Kami menunjukkan a wPemasangan paip di Cx. pipiens (s.l.) populasi di Turki dengan menganalisis 753 sampel dari 59 lokasi persampelan. Tiga wKumpulan pip dikesan di rantau ini: wPaip-I, wPip-II dan wPaip-IV. Kumpulan yang paling dominan adalah wPip-II. Semasa wPip-IV hanya terhad kepada dua lokasi, wPip-I dan wPip-II mempunyai pengedaran yang lebih luas. Individu yang dijangkiti wPip-II didapati wujud bersama dengan individu yang dijangkiti wPip-I atau wPip-IV di beberapa laman persampelan. Dua garis isofemal nyamuk yang mengandungi sama ada a wPip-I atau a wStrain Pip-II ditubuhkan dari populasi di barat laut Turki. Salib timbal balik antara garis-garis ini menunjukkan bahawa mereka saling sesuai sepenuhnya tetapi secara dua arah tidak sesuai dengan wTalian dijangkiti Pip-IV Istanbul.

Kesimpulannya

Penemuan kami menunjukkan kepelbagaian tinggi wPip dan CI sifat di Cx. pipiens (s.l.) penduduk di Turki. Pengetahuan mengenai corak CI yang berlaku secara semula jadi yang disebabkan oleh wKepelbagaian paip di Turki mungkin berguna untuk Cx. pipiens (s.l.) kawalan di rantau ini.


Jangkitan Wolbachia dan ketidaksesuaian sitoplasma pada spesies Drosophila

Empat puluh satu stok dari 30 spesies Drosophila disurvei untuk jangkitan Wolbachia menggunakan teknologi PCR. D. sechellia dan dua strain D. auraria didapati dijangkiti dan diuji untuk menyatakan ketidaksesuaian sitoplasma, bersama dengan strain D. ananassae dan D. melanogaster, yang sudah diketahui dijangkiti. D. ananassae dan D. melanogaster menunjukkan tahap ketidakcocokan hingga 25%, sementara D. auraria dan D. sechellia menunjukkan tahap kematian telur sekitar 60%. Uji dot-blot menggunakan urutan dnaA sebagai probe dikembangkan untuk menilai tahap jangkitan pada individu lelaki yang digunakan dalam persilangan ketidaksesuaian. Hubungan positif antara ketumpatan bakteria dan ketidaksesuaian sitoplasma diperhatikan. Stok yang diperiksa dapat dikelompokkan menjadi sekurang-kurangnya dua kelompok, bergantung pada tahap jangkitan relatif terhadap tahap ketidaksesuaian sitoplasma yang ditunjukkan. Satu kumpulan, yang mengandungi D. simulans Hawaii, D. sechellia, dan D. auraria, menunjukkan tahap ketidaksesuaian sitoplasma yang tinggi berbanding tahap jangkitan semua spesies lain dan D. simulans Riverside menunjukkan tahap ketidaksesuaian sitoplasma yang jauh lebih rendah berbanding tahap jangkitan . Data ini menunjukkan bahawa, selain kepadatan bakteria, faktor bakteria dan / atau inang juga mempengaruhi ungkapan ketidaksesuaian sitoplasma.


Pada mekanisme Wolbachia-kesan ketidaksesuaian sitoplasma: Menghadapi model dengan fakta

Bakteria endoselular Wolbachia memanipulasi pembiakan hos arthropoda untuk kepentingannya sendiri dengan pelbagai cara, yang paling banyak adalah ketidaksesuaian sitoplasma (CI). Sehingga kini, mekanisme molekul yang terlibat dalam CI belum dapat dijelaskan. Kami meneliti di sini tiga model CI yang berbeza yang dijelaskan dalam literatur sebelumnya, yaitu, model "kunci-dan-kunci", "titrasi-restitusi" dan "gerakan lambat". Kami menghadapinya dengan pelbagai corak CI yang ditemui setakat ini, termasuk yang paling kompleks seperti pelbagai jangkitan, hubungan keserasian asimetris dan separa dan kewujudan Wolbachia varian yang dapat menyelamatkan host dari CI tetapi tidak mendorongnya. Kami menyimpulkan bahawa model kunci dan kunci adalah model yang paling teliti dan sesuai dengan pemerhatian. Dua model lain tidak boleh dikategorikan tidak sah, tetapi mereka menghadapi beberapa kesukaran yang menjadikan hipotesis tambahan diperlukan. BioEsays 25: 259–265, 2003. © 2003 Wiley Periodicals, Inc.


Bahan dan kaedah

Kaji spesies

Kesan usia lelaki dan kadar kawin pada induksi CI dan pemindahan sperma disiasat di D. simulan. Lalat dijangkiti Wolbachia Riverside ketegangan (wRi) pada asalnya dikumpulkan dari Riverside, California (AS), dan dipelihara dalam populasi makmal yang besar sejak tahun 2003 (diperoleh dari G. Hurst, UCL, yang berasal dari strain Riverside ‘89 seperti yang dijelaskan dalam Hoffmann et al., 1990). Lalat yang tidak dijangkiti diperoleh dengan rawatan antibiotik (tetrasiklin hidroklorida) sebilangan besar lalat yang dijangkiti sekurang-kurangnya 2 tahun sebelum percubaan. Sebilangan besar individu yang terlibat dalam proses penghapusan jangkitan bermaksud bahawa tidak mungkin populasi yang tidak dijangkiti mengalami kemurungan pembiakan atau berbeza dalam latar belakang genetik dari populasi yang dijangkiti. Oleh itu, sebarang perbezaan antara populasi yang dijangkiti dan tidak dijangkiti mungkin disebabkan oleh kehadiran / ketiadaan Wolbachia. Kedua-dua populasi yang dijangkiti dan tidak dijangkiti dijaga dalam keadaan yang sama pada 25 ° C pada kitaran cahaya / gelap 12: 12-jam dengan bekalan makanan dan medium yang berterusan untuk bertelur.

Status jangkitan lalat dari populasi yang dijangkiti dan tidak dijangkiti disahkan oleh reaksi berantai polimerase (PCR). Sejagat Wolbachia- primer khusus (Wsp 81F dan Wsp 691R) digunakan. Status jangkitan disahkan sebelum dan sesudah percobaan menggunakan prosedur seperti yang dijelaskan dalam Champion De Crespigny et al. (2006). Status jangkitan yang dijangkakan disahkan dalam semua kes.

Pengumpulan telur dan larva

Telur dikumpulkan dari populasi stok dengan memasukkan piring kecil petri yang mengandungi media bertelur telur standard (12.5 g agarose, 275 mL air deionisasi, 150 mL jus anggur dan 0.5 g Nipagin) dan 0.5 g pasta ragi ke dalam sangkar populasi. Jumlah ragi dikawal sekiranya ini mempengaruhi spermatogenesis lelaki. Telur dikumpulkan setiap 24 jam selama 8 hari berturut-turut. Larva dikumpulkan pada waktu pagi dengan penunjuk logam dan dimasukkan ke dalam botol berisi 15 mL Drosophila sederhana. Mereka diternak dengan ragi rendah biasa Drosophila sederhana (10 g agarosa, 20 g yis, 85 g gula pasir, 60 g jagung, 1000 mL air deionisasi dan 1 g Nipagin). Hanya 25 larva individu dimasukkan ke dalam setiap botol untuk mengawal ketumpatan larva dan memastikan larva iklan libitum makanan semasa proses pemeliharaan. Lalat diternak pada kitaran cahaya / gelap 12: 12-jam. Kira-kira 500 larva setiap status jangkitan dikumpulkan setiap hari.

Koleksi dewasa dan hubungan seks

Kira-kira 8-9 hari setelah telur diletakkan, orang dewasa mula gerhana. Botol diperiksa setiap 6 jam (tiga kali selama kitaran cahaya) untuk lalat yang baru ditutup. Orang dewasa baru didinginkan di atas ais, melakukan hubungan seks, dan jantina diletakkan di dalam botol berasingan yang berisi Drosophila sederhana dengan 40 individu setiap botol. Proses ini memastikan bahawa semua lalat dewasa adalah perawan pada awal eksperimen. Kedua-dua lalat jantan dan betina disimpan pada suhu 25 ° C pada kitaran cahaya / gelap 12: 12-jam.

Percubaan Induksi CI CI

Untuk mengkaji kesan sejarah kawin dan usia lelaki terhadap induksi CI, kadar kawin lelaki dan sejarah kawin dimanipulasi dengan teliti. Untuk menyiasat kesan kadar kawin pada CI dan untuk membezakan kesan kadar kawin dengan kesan penuaan, tiga rawatan yang berbeza digunakan. Pertama, untuk mengawal kesan usia lelaki pada induksi CI, lelaki yang dijangkiti dara berusia 5, 6, 7, 8 atau 11 hari dikawan dengan wanita yang tidak dijangkiti perawan dan kejayaan CI / penetasan dijumpai (lihat di bawah untuk prosedur dan juga Jadual 1 ) (satu kawin hanya untuk setiap lelaki pada usia yang ditetapkan). Perlakuan ini disebut sebagai ‘kawalan penuaan - SC’. Di bawah rawatan kedua - kadar kawin rendah (LMR), lelaki berkawan dengan wanita dara tunggal yang tidak dijangkiti ketika mereka berumur 4, 5, 6, 7, 8 dan 11 hari, masing-masing (6 pasangan untuk setiap lelaki), dan Kejayaan CI / penetasan dicetak untuk setiap pasangan ini (lihat di bawah). Dalam rawatan terakhir - kadar kawin tinggi (HMR), lelaki dikawinkan dengan tiga wanita dara yang tidak dijangkiti ketika mereka berusia 4, 5, 6, 7, 8 dan satu kawin ketika mereka berusia 11 hari (total 16 pasangan untuk setiap lelaki ). Hanya wanita pertama yang dijodohkan oleh lelaki HMR setiap hari untuk mencetak kejayaan CI / penetasan.

Rawatan Lelaki Saiz sampel Sejarah kawin lelaki
Lelaki penuaan Dijangkiti 15 setiap umur Lelaki dara dan kawin tunggal setiap hari
Tidak dijangkiti 15 setiap umur Lelaki dara dan kawin tunggal setiap hari
Kadar kawin rendah Dijangkiti 20 6 perkahwinan secara keseluruhan bagi setiap lelaki
Tidak dijangkiti 20 6 perkahwinan secara keseluruhan bagi setiap lelaki
Tahap kawin yang tinggi Dijangkiti 25 16 perkahwinan secara keseluruhan bagi setiap lelaki
Tidak dijangkiti 25 16 perkahwinan secara keseluruhan bagi setiap lelaki

Pada awal eksperimen, lalat jantan berusia 3 hari dimasukkan ke dalam botol kawin 7.5 × 2.5 cm (satu jantan / botol). Mereka dibahagikan kepada rawatan SC, LMR dan HMR secara rawak dengan ukuran sampel masing-masing 15, 20 dan 25 lalat. Untuk rawatan SC, ukuran sampel adalah 15 lelaki setiap umur individu. Lalat betina yang tidak dijangkiti dara tunggal (berusia 4-5 hari) ditambahkan ke setiap botol pada awal perkawinan setiap hari (sesuai dengan rawatan) dan dikeluarkan setelah penyusunan selesai. Kami mencatatkan masa lelaki mula mengawan (TSM) dan lelaki jodoh selesai (TFM). Sebaik sahaja kawin selesai, lalat betina dipindahkan ke ragi rendah berwarna Drosophila sederhana hingga oviposit. Telur diinkubasi selama 24 jam pada 25 ° C pada kitaran cahaya / gelap 12: 12-jam. 24 jam selepas itu, wanita TFM dikeluarkan, dibekukan dan status jangkitan pada wanita kemudian disahkan oleh PCR. Telur yang dilahirkan oleh betina dalam 24 jam setelah kawin dihitung dua kali: 48 dan 72 jam setelah TFM. Namun, pada 72 jam, hanya telur yang belum dipetik yang dihitung.

Peratusan semua telur yang dilahirkan oleh setiap betina dalam tempoh 24 jam setelah mengawan yang kemudiannya menetas disebut kejayaan menetas. Peratus kejayaan penetasan digunakan sebagai ukuran ekspresi CI. Ekspresi CI penuh akan menghasilkan kejayaan penetasan 0%. Peningkatan peratusan telur yang menetas bermaksud penurunan ekspresi CI dan pemulihan kesesuaian pembiakan. Oleh itu, CI berkaitan secara negatif dengan kejayaan menetas.

Percubaan pemindahan sperma

Rawatan dan prosedur kawin

Tiga rawatan yang dijangkiti dan tiga yang tidak dijangkiti (Jadual 1) digunakan untuk menyelidiki kesan status jangkitan, usia lelaki dan kadar kawin pada jumlah sperma yang dipindahkan ke wanita pada saat penyusuan. Dalam semua kes, wanita tidak dijangkiti Wolbachia. Lelaki yang dijangkiti dan tidak dijangkiti secara rawak dialokasikan untuk rawatan SC, LMR dan HMR (mengikut eksperimen induksi CI yang dijelaskan sebelumnya) (Jadual 1) dengan ukuran sampel 15, 20 dan 25 lalat untuk masing-masing rawatan. Sama seperti eksperimen induksi CI, lelaki berumur 4, 5, 6, 7, 8 dan 11 hari dan wanita yang tidak dijangkiti 4-5 hari digunakan. Pada awal setiap hari percubaan, lalat betina tunggal ditambahkan ke dalam botol setiap lelaki. TSM dan TFM direkodkan. Sebaik sahaja kawin selesai, lalat betina dipindahkan ke tiub Eppendorf dan dibekukan dalam nitrogen cair 40 minit selepas TFM. Betina kemudian dipindahkan ke peti sejuk −80 ° C untuk pembedahan kemudian.

Sperma disimpan dalam bekas mani wanita (SR) dan spermathecae pasangannya (Gillott, 2005). Waktu yang tepat untuk penyimpanan sperma tidak diketahui D. simulan. Dalam kajian terpisah sebelum eksperimen ini, kami menentukan waktu optimum untuk menghitung sperma di rahim wanita sebelum penyimpanan di SR dan spermathecae wanita (data tidak disajikan). Menghitung sperma di rahim lebih disukai kerana kesukaran yang berkaitan dengan membedah SR dan spermathecae. Rahim mengandungi jumlah sperma paling banyak 40 minit selepas akhir kawin. Oleh itu, betina dibekukan dalam nitrogen cair 40 minit selepas TFM dalam eksperimen ini.

Prosedur pembelahan dan pengiraan sperma

Lalat betina beku dicairkan pada suhu bilik selama sekurang-kurangnya 10 minit sebelum pembedahan kerana rehidrasi membantu memisahkan kumpulan sperma ke dalam sperma secara lebih baik. Sistem pembiakan wanita terletak di bahagian belakang abdomen ventral dan rahim di bahagian akhir sistem pembiakan (Wilt & Hake, 2003). Larutan penyangga fosfat (PBS) digunakan sebagai medium asas untuk memelihara sperma. 50 μL PBS dimasukkan ke slaid mikroskopik. Lalat betina diletakkan di sebelah PBS di bawah mikroskop pembedah. Tubuh dipicit dengan lembut dengan pinset untuk menonjol saluran ovipositor yang ditarik keluar dengan pinset halus. Rahim segera dimasukkan ke dalam PBS. Jarum pemotongan halus digunakan untuk memotong organ bulat di hujung anterior rahim. Jarum digunakan untuk menahan ujung potongan yang berlawanan, dan dengan jarum lain, sperma diperah keluar. Bahagian wanita dikeluarkan dan sperma dicampurkan dengan PBS. Sebilangan kecil 50 μL PBS ditambahkan dan dicampurkan. Slaid dibiarkan selama 24 jam hingga kering sebelum direndam ke dalam air deionisasi dua kali selama 10 saat. Slaid dibiarkan ditutup pada sudut 45 ° selama 24 jam lagi. Sperma dihitung di bawah medan gelap pada pembesaran 100 ×. Kumpulan sperma dan sperma individu dihitung. Setiap kumpulan mengandungi 64 sperma (Snook et al., 2000 ).

Statistik

Pengukuran berulang anova digunakan untuk menyiasat kesan usia lelaki dan sejarah kawin pada induksi CI dan kesan status jangkitan, usia lelaki dan sejarah kawin pada jumlah sperma yang dipindahkan semasa kopulasi (lihat Jadual 1). Pembetulan Bonferroni diterapkan pada semua anova pengukuran berulang untuk mengendalikan beberapa perbandingan. Di samping itu, penyesuaian dibuat terhadap bilangan darjah kebebasan zaman dalam eksperimen induksi CI oleh Greenhouse – Giesser kerana kekasaran yang dilanggar (Greenhouse & Geisser, 1959). Homogenitas lereng antara rawatan sejarah kawin dibandingkan dengan ancova dalam eksperimen induksi CI. Data disajikan sebagai min ± SE. SPSS versi 20 digunakan untuk menganalisis data.


Pilihan akses

Dapatkan akses jurnal penuh selama 1 tahun

Semua harga adalah harga BERSIH.
PPN akan ditambahkan kemudian semasa pembayaran.
Pengiraan cukai akan diselesaikan semasa pembayaran.

Dapatkan akses artikel terhad atau masa penuh di ReadCube.

Semua harga adalah harga BERSIH.


Umur lelaki dan Wolbachia dinamika: Menentukan seberapa cepat dan mengapa ketumpatan bakteria dan kekuatan ketidaksesuaian sitoplasma berbeza-beza

Endosimbiotik Wolbachia bakteria menjangkiti host arthropod dan nematode yang berbeza. Banyak strain menyebabkan ketidaksesuaian sitoplasma (CI) yang membunuh embrio yang tidak dijangkiti disenyawakan oleh Wolbachia-mengubah sperma. Embrio yang dijangkiti dilindungi dari CI, mempromosikan Wolbachia merebak ke frekuensi keseimbangan tinggi yang seimbang dengan penghantaran ibu yang tidak sempurna. Kekuatan CI berbeza secara semula jadi dan cenderung menurun seiring usia lelaki. Memahami sebab-sebab variasi kekuatan CI sangat penting untuk dijelaskan Wolbachia kelaziman dalam populasi tuan rumah. Di sini, kami menyiasat seberapa cepat dan mengapa kekuatan CI menurun dengan usia lelaki dalam dua sistem model: wMel masuk Drosophila melanogaster dan wRi di D. simulan. Rata-rata wKekuatan Mel CI menurun dengan cepat (19% / hari), dan wKekuatan Ri CI menurun secara perlahan (6% / hari) seiring usia lelaki sehingga, dalam masa tiga hari, wLelaki yang dijangkiti mel tidak menyebabkan CI, sedangkan berusia dua belas hari wLaki-laki yang dijangkiti Ri masih menyebabkan CI yang kecil, namun ketara. Kami menguji sama ada pengurangan dalam Wolbachia ketumpatan atau ekspresi gen CI kerana usia lelaki dapat menjelaskan corak ini. Sesungguhnya, wKetumpatan Ri dan ekspresi gen CI menurun pada testis seiring usia lelaki, tetapi wKetumpatan Mel dan ekspresi gen CI secara mengejutkan meningkat dengan usia lelaki kerana kekuatan CI menurun. Aktiviti litik Phage WO dan wNombor salinan Mel Octomom — kawasan gen amplikonik yang mempengaruhi wPercambahan mel - jangan menjelaskan bergantung kepada usia Wolbachia ketumpatan. Walau bagaimanapun, ungkapan Relish, gen penting dalam Drosophila laluan kekurangan imun, sangat berkaitan dengan wKetumpatan mel. Bersama-sama, hasil ini menunjukkan bahawa seluruh testis Wolbachia ketumpatan dan ekspresi gen CI tidak mencukupi untuk menjelaskan kekuatan CI yang bergantung pada usia di semua strain dan itu Wolbachia ketumpatan dipengaruhi oleh usia lelaki di seberang Wolbachia-persatuan pelawat. Kami membuat hipotesis bahawa kekebalan tuan rumah dapat mendasari variasi dalam dinamika kepadatan yang bergantung pada usia. Secara lebih meluas, penurunan pesat dari wKekuatan Mel CI pada minggu pertama D. melanogaster kehidupan mungkin menyumbang kepada wVariasi frekuensi mel diperhatikan di beberapa benua.


Eksperimen ini menunjukkan bahawa, setelah rawatan antibiotik untuk menghilangkan Wolbachia, N. giraulti dan N. longicornis boleh berkahwin untuk menghasilkan keturunan yang sihat tanpa bukti kematian, kemandulan atau penyakit hibrid F1 / F2. WolbachiaKetidaksesuaian sitoplasma yang disebabkan oleh itu nampaknya telah mendahului mekanisme pengasingan yang lain. Walaupun eksperimen ini menunjukkan tahap pengasingan pra-pasangan separa dalam satu arah, namun sumbangannya Wolbachia nampaknya menjadi penghalang biologi yang paling ketara untuk pembiakan silang.

Pengasingan mikroba berpotensi memberikan kekuatan evolusi yang cepat yang mengatasi unsur-unsur klasik mutasi dan aliran genetik. Walau bagaimanapun, dari segi sifatnya, teori evolusi hampir mustahil untuk dibuktikan, dan masih ada sedikit bukti untuk spekulasi berjangkit di alam liar. Sebaliknya, ciri seperti pengasingan geografi cenderung memainkan peranan utama. Faktor kelayakan lain yang bertindak pada tahap Wolbachia parasit itu sendiri merangkumi variasi semula jadi dalam penembusan dan penularan jangkitan, yang kedua-duanya memungkinkan tahap aliran gen antara populasi inang. Penghantaran mendatar dari Wolbachia antara host juga akan bertindak membalikkan kesan ketidaksesuaian sitoplasma. Tetapi penemuan kajian ini dan di mana-mana Wolbachia jangkitan di alam menunjukkan bahawa CI mungkin memperkuat spesiasi daripada menggerakkannya secara langsung. Kajian yang sedang dijalankan telah mengenal pasti bakteria lain yang mampu menyebabkan CI dan potensi pengaruh biologi jangkitan seperti itu akan segera menjadi lebih jelas.


Pengenalan

Parasit pembiakan seperti bakteria intraselular Wolbachia memanipulasi sistem pembiakan tuan rumah mereka untuk kepentingan mereka sendiri. Selalunya, Wolbachia menyebabkan ketidaksesuaian telur sperma, yang dikenali sebagai ketidaksesuaian sitoplasma (lihat [1], [2] untuk ulasan). Bersama dengan halangan geografi atau genetik untuk aliran gen, ketidaksesuaian sitoplasma (CI) dapat mendorong evolusi pengasingan pembiakan, komponen penting dalam spesiasi [3] - [6]. Wolbachia disebarkan secara meluas di arthropoda, dengan anggaran 20% hingga 70% spesies serangga yang dijangkiti bakteria [7] - [9]. Oleh itu, menangani sama ada Wolbachia mempengaruhi proses spesiasi hosnya adalah persoalan penting. Di sini, kami mengkaji secara teorinya kesan CI unidirectional pada spesiasi. Pendekatan pemodelan kami sesuai dengan literatur teoritis mengenai kedua-dua spesiasi dengan peneguhan dan pencerobohan pengubah kawin (mis. [10] - [13]).

Ketidaksesuaian sitoplasma (CI) adalah ketidaksesuaian pasangan yang disebabkan oleh Wolbachia (lihat [14] untuk tinjauan). Ia dipanggil sitoplasma kerana Wolbachia disebarkan dari ibu melalui sitoplasma telur ke keturunan. Terdapat dua bentuk asas. Unirectional CI melibatkan satu Wolbachia ketegangan. Sekiranya bapa dijangkiti Wolbachia kemudian kawin dengan wanita yang tidak dijangkiti (atau wanita yang dijangkiti dengan ketegangan yang berbeza) mempunyai penurunan keturunan yang masih hidup dibandingkan dengan pasangan lain yang mungkin. Ini disebabkan oleh ketidaksesuaian antara telur dan sperma [15]. CI dua arah disebabkan oleh dua Wolbachia regangan dan boleh berlaku ketika pasangan kawin dijangkiti strain yang berbeza.

Ketidaksesuaian sitoplasma telah menarik perhatian sebagai mekanisme yang mungkin untuk spesiasi cepat [1], [3], [4], [6], [16] - [18]. Idea asasnya ialah CI mengurangkan aliran gen antara populasi, membenarkan perbezaan genetik dan memilih untuk pengasingan prematur. Dalam kes CI dua arah terdapat bukti empirikal dan teori yang menyokong pandangan ini. Kajian lapangan menunjukkan bahawa banyak spesies serangga mempunyai pelbagai jenis Wolbachia, sering di kawasan geografi yang berbeza [19] - [22]. Selanjutnya, percubaan menyeberang menunjukkan bahawa CI dua arah adalah faktor pengasingan utama antara beberapa strain dan spesies yang berkait rapat [4], [5], [17], [23] - [25]. Secara teorinya, telah ditunjukkan bahawa dua Wolbachia strain dapat wujud secara stabil dalam populasi inang parapatrik dalam menghadapi migrasi yang besar [26], dan CI bidirectional mengurangkan aliran gen alel yang disesuaikan secara tempatan dan memilih untuk pengasingan pramatang walaupun penghantaran Wolbachia dan tahap ketidaksesuaian tidak lengkap [6], [27], [28].

Walau bagaimanapun, pandangan bahawa Wolbachia adalah faktor penting dalam spesiasi arthropod kontroversial [3], [18], [29] - [32]. Kritikan umum adalah bahawa CI dua arah (mod yang jelas dapat mendorong penurunan timbal balik dalam aliran gen) tidak biasa, bahawa tahap CI tidak mencukupi untuk memungkinkan perbezaan genetik, dan bahawa CI tidak berkesan dalam mempromosikan evolusi pengasingan prematur .

CI searah mungkin lebih biasa di alam, kerana ia memerlukan hanya satu populasi yang dijangkiti Wolbachia. Walau bagaimanapun, CI unidirectional pada umumnya tidak diyakini dapat mempromosikan spesiasi pada host kerana pemeliharaan populasi yang dijangkiti dan tidak dijangkiti dijangka tidak stabil sekiranya berlaku migrasi. Oleh itu, perbezaan CI tidak akan berterusan dan aliran gen akan menghilangkan perbezaan antara populasi yang berbeza. Contoh yang menonjol untuk ketidakstabilan CI unidirectional adalah penyebaran cepat Wolbachia dalam Drosophila simulans California [33]. Walau bagaimanapun, dalam kajian lapangan lain jangkitan campuran telah diperhatikan antara populasi spesies [5], [34], [35]. Salah satu contohnya ialah ketiadaan Wolbachia pada populasi semut api yang menyerang di Amerika Utara, tetapi terdapat jangkitan pada populasi sumber di Amerika Selatan [5]. Corak sebaliknya juga dijumpai, kehadiran Wolbachia dalam diedarkan secara global Pipiens Culex tetapi ketiadaannya dalam populasi sumber berpotensi yang lebih kecil di Afrika Selatan [35]. Selanjutnya, dalam memberi makan cendawan Drosophila CI unidirectional antara spesies yang dijangkiti dan tidak dijangkiti yang berkait rapat mungkin merupakan faktor utama pengasingan genetik [5], [36]. Pengukuhan pengasingan pembiakan nampaknya berlaku di zon hubungan. Kajian eksperimen ini menunjukkan bahawa pemodelan lebih lanjut mengenai dinamika CI unidirectional dan kemungkinan peranannya dalam mempromosikan pengasingan pembiakan diperlukan. Persoalan asasnya ialah apakah ada keadaan di mana CI unidirectional dapat membuat corak jangkitan yang stabil dan apakah ini memilih untuk perbezaan genetik dan pengasingan prematur. Sejauh ini terdapat satu kajian teori yang menangani persoalan ini. Flor et al. [37] menunjukkan secara analitis bahawa populasi inang parapatric yang dijangkiti dan tidak dijangkiti dapat hidup bersama jika migrasi berada di bawah kadar migrasi kritikal. Kadar penghijrahan kritikal terbukti positif sekiranya Wolbachia menyebabkan pengurangan fekunditi dalam hos atau penghantarannya tidak lengkap.

Dalam kajian ini kita menyiasat peranan Wolbachia-CI unidirectional yang disebabkan pada spesiasi host lebih umum. Kami pertama kali mempertimbangkan syarat-syarat yang membenarkan pemeliharaan perbezaan jangkitan antara daratan yang dijangkiti dan penduduk pulau yang awalnya tidak dijangkiti dengan adanya penghijrahan sehala dan penyesuaian tempatan. Kami kemudian mengikuti Telschow et al. [6] dan menggabungkan model untuk Wolbachia dinamik [27], [38] dengan model pengukuhan yang dikaji dengan baik [13]. Model baru ini membolehkan kita menyiasat kesan CI unidirectional terhadap perbezaan genetik host. Kami menganggap pemilihan bertindak pada populasi pulau kecil (awalnya tidak dijangkiti) yang mengalami penghijrahan dari populasi daratan yang besar (dijangkiti). Model ini merangkumi lokasi pilihan pasangan, lokus sifat lelaki yang menjalani pemilihan berbeza dalam dua populasi, dan ketidaksesuaian sitoplasma. Dalam kajian ini kita menunjukkan bahawa populasi pulau yang rendah Wolbachia kekerapan jangkitan dapat mengekalkan penyesuaian tempatan dalam menghadapi migrasi lebih baik daripada populasi pulau yang mempunyai jangkitan. Apabila digabungkan, alel yang disesuaikan secara tempatan dan perbezaan jangkitan kedua-duanya stabil pada kadar penghijrahan yang lebih tinggi daripada mana-mana sahaja. Selain itu, perbezaan jangkitan antara daratan dan pulau memungkinkan pengasingan pramatang berkembang dengan lebih mudah. Hasilnya menunjukkan bahawa, jika populasi periferal berulang berlaku, mereka yang kehilangannya Wolbachia yang lebih cenderung menyimpang ke spesies baru, dan CI unidirectional dapat memilih untuk pengasingan prematur dengan penguatan diskriminasi pasangan.


Bahan dan Kaedah

Penjujukan Urutan dan Ramalan Struktur.

Pelbagai jujukan ortologi CinB dari beberapa Wolbachia strain dan nuklease PD- (D / E) xK yang diketahui dihasilkan menggunakan program Cluster Omega Multiple Sequence Alignment dari EMBL-EBI diikuti dengan penyesuaian manual (33). Ramalan struktur sekunder dan penjajaran urutan protein dilakukan menggunakan program PSIPRED Protein Sequence Analysis Workbench (34). Ramalan struktur CinB wPip dilakukan menggunakan pelayan Ramalan Struktur RaptorX dengan beberapa kawasan tidak berstruktur dikeluarkan di Lampiran SI, Rajah S1 (35).

Imunoblotting Barat.

Antibodi berikut digunakan: tetikus anti-FLAG M2 (Sigma 1: 10,000), tetikus 16B12 anti-HA (Covance 1: 1,000), tetikus anti-PGK (Molecular Probes 1: 20,000), dan lobak peroksidase (HRP) -konjugasi NA931V anti-tetikus domba (GE Healthcare 1: 10,000). Sampel protein diselesaikan dengan SDS / PAGE dan dipindahkan ke membran PVDF (Millipore) untuk imunoblotting. Protein divisualisasikan oleh chemiluminescence berasaskan HRP (36).

Pemurnian Protein untuk Ujian In vitro Nuclease dan ITC.

CinB panjang penuh, mutan CinB yang tidak aktif secara pemangkin (K279A, K636A, dan KK279 / 636AA), CidB1–761(V686E / R688K), dan CinA dinyatakan sebagai gabungan GST dari vektor pGEX6P1 di Rosetta DE3 (Novagen) E coli seperti yang telah dijelaskan sebelumnya (9). Untuk mengurangkan kemungkinan penyatuan CinB dengan DNA, kami menggunakan protokol untuk mengasingkan protein bebas DNA yang dijelaskan oleh Epling et al. (25) (Lampiran SI, Bahan dan Kaedah).

Calorimetri Titrasi Isotermal.

Eksperimen ITC dilakukan pada suhu 25 ° C menggunakan NanoITC (TA Instruments). Pertama, CinA wPaip dan CinB wPip dialisis secara meluas terhadap penyangga Hepes 50 mM (pH 7.4) selama 2 d dengan pertukaran buffer 3 atau 4. Untuk menentukan pertalian CinB untuk CinA, 500 μM CinA dimasukkan ke dalam picagari dan dititratkan ke dalam larutan CinB 50 μM. Sebanyak 22 suntikan (2 μL setiap suntikan) dilakukan sepanjang eksperimen dengan jarak 300 s antara suntikan untuk memastikan kembali ke awal sebelum suntikan berikutnya. Data dibetulkan awal menggunakan NITPIC dan dianalisis dalam SEDPHAT menggunakan model pengikat 1-laman (A + B → AB). Gambar 3 disediakan dalam GUSSI, yang dimuat turun dari halaman perisian MBR (http://biophysics.swmed.edu/MBR/software.html) (37 ⇓ –39).

Ujian Nuclease.

Semua ujian aktiviti nuclease in vitro dilakukan dengan CinB panjang penuh wPaip (residu 1 hingga 733) dengan atau tanpa CinA wPaip (residu 1 hingga 446). Untuk ujian aktiviti DNase dan RNase, 1 μM protein mutan CinB atau CinB diinkubasi dalam buffer reaksi yang mengandungi 20 mM Hepes (pH 8.0), 5 mM MgCl2, 2.5% sukrosa, 150 mM NaCl, 0.001% Triton X-100, dan 2 mM DTT dengan 15 nM sama ada pBluescript SK + linear atau supercoiled, 500 nM single-strand atau double-stranded DNA berlabel Cy5 [70-mer: Cy5- GCAATTCGATCGTTGACATCTCGCGTGCTCGGTCAATCGGCAGATGCGGAGTGAAGTTCCAACGTTCGGC-3 ′, yang sebelumnya digunakan untuk analisis pemecahan ssDNA (40, 41) 45-mer: Cy5-GGGTCAACGTGGCAAAGGCGGGGGGGGGGGGGGA untuk menghasilkan dsDNA], atau 500 ng salah satu ragi tRNA (Thermo Fisher) atau D. melanogaster jumlah RNA (40, 41). Dalam reaksi di mana CinA hadir, 10 μM CinA digunakan. Semua tindak balas dilakukan pada suhu 25 ° C selama 90 minit dan dipadamkan dengan menambahkan EDTA pada kepekatan akhir 10 mM kecuali dinyatakan sebaliknya. Untuk tindak balas menggunakan vektor atau RNA pBluescript linier atau bulat, sampel dijalankan dalam gel agarose dengan julat kepekatan antara 0,8 dan 2,0% yang mengandungi 0,4 μg / mL etidium bromida dalam 1 × TAE buffer pada 100 V selama 40 hingga 60 min dan digambarkan pada kotak Syngene G: dengan perisian GeneTools. Untuk reaksi menggunakan oligodeoxynucleotides berlabel Cy5, sampel dijalankan dalam gel asli poliakrilamida TBE 9% pada suhu 100 V selama 45 hingga 60 minit dan dicitrakan pada Typhoon FLA 7000 dengan perisian kawalan Typhoon FLA 7000.

Kaedah Ragi.

Uji pertumbuhan ragi yang ditunjukkan dilakukan pada strain BY4741 (42). Plasmid 2-μm pYES2 (URA3) menggunakan a GAL1 penganjur dan a CYC1 terminator dan digunakan untuk ekspresi CinB yang tidak dapat di galaktosa dalam ragi. Uji pertumbuhan ragi dan imunoblotting dilakukan seperti yang dijelaskan sebelumnya (9) (Lampiran SI, Bahan dan Kaedah).

Drosophila Analisis Kadar Hatch dan Sitologi.

Setiap gen calon CI (cinA, cinB, cinB-K636A, dan cinA-T2A-cinB) dimasukkan ke dalam vektor pUASp-attB dengan teknik pengklonan standard tanpa pengoptimuman kodon. Secara ringkas, ORF gen diperkuat dengan PCR dan diklon ke vektor SKB pBluescript diikuti dengan pencernaan sekatan dan penyatuan semula gen ke dalam vektor pUASp-attB. Semua plasmid disahkan dengan mengurutkan gen yang dimasukkan sepenuhnya sebelum dihantar ke BestGene untuk suntikan mikro D. melanogaster embryos (9). Fly background 9744 was chosen for all gene constructs for site-directed attP/B integration on the third chromosome by PhiC31 integrase (26) with the exception that background 9723 was chosen for site-specific integration of cinA on the second chromosome. Integrations were confirmed independently by PCR amplifying the candidate genes (43, 44). D. melanogaster stocks were verified to be uninfected with native Wolbachia isolates by PCR amplification of the cidA wMel gene (SI Appendix, Fig. S6). The MTD-Gal4 line from the Bloomington Stock Center was found to be infected by wMel and was treated by addition of 20 μg/mL tetracycline to the growth medium for 3 generations. Once the infection was confirmed to be cleared by PCR amplification of the cidA wMel gene, flies were reared on untreated media for at least 3 additional generations to allow for mitochondrial recovery (45). Both uninfected and wNo-infected D. simulans were also verified by PCR amplification of the cinB wNo gene (SI Appendix, Fig. S6). Flies were reared on standard cornmeal-based solid media and maintained at room temperature. During virgin female collection, stocks were maintained at 18 °C overnight and room temperature the following day. All transgenic flies were maintained as homozygous lines.

Parental flies were generated by crossing either NGT-Gal4 or MTD-Gal4 virgin females with cin transgenic males (27, 29). Only the males emerging between 0 and 30 h from these crosses were collected and used in CI analyses (46). All flies used in both hatch-rate and cytological analyses were aged for 2 to 4 d. Hatch-rate analysis was performed and embryos for cytological analyses were prepared similarly as previously described (9, 10) (SI Appendix, Bahan dan Kaedah). The samples were stained with either Hoechst 33342 at 1:1,000 in PBTA or 1 μg/mL propidium iodide (9, 10). Stained embryos were mounted on glass slides and sealed under coverslips by nail polish. Imaging was done either on a Zeiss Axioskop microscope with AxioCam MRm camera using 10× and 40× objective lenses or a Zeiss LSM 880 Airyscan/NLO confocal microscope with internal PMT using a 20× objective lens. Software used to capture and analyze the images were AxioVision Rel. 4.8 or Zen (blue edition), respectively.

Statistical Analyses.

All statistical analyses were done in GraphPad Prism 7. Hatch-rate analyses were performed by either using 1-way ANOVA with pairwise comparison after removal of outliers identified by the ROUT method with Q = 1% (Fig. 5 C dan D) or unpaired 2-tailed Mann–Whitney U test (Fig. 5E dan SI Appendix, Fig. S4). Pairwise χ 2 test was used in cytological analyses to compare normal and defect cytological phenotypes.

Data Availability.

Quantitative analyses for this study are provided in Dataset S1.


Tonton videonya: 10. Genomic Conflict (Januari 2022).